Les plaies, l’incapacité fonctionnelle et les dispositifs à demeure sont associés à la co-colonisation par Staphylococcus aureus résistant à la méthicilline et les entérocoques résistants à la vancomycine dans le sud-est du Michigan

Contexte Le Staphylococcus aureus résistant à la méthicilline reste sensible à la vancomycine; Quand le SRS aureus résistant à la vancomycine apparaît, le traitement devient plus complexe L’émergence de la VRSA est attribuée au transfert conjugatif du groupe de gènes de résistance à la vancomycine des entérocoques résistants à la vancomycine VRE au SARM car la cocolonisation avec SARM et ERV précède le développement de la SARV, cette étude étudie l’épidémiologie Une étude d’observation prospective menée sur des SNF dans le sud-est du Michigan Dans l’ensemble, les résidents ayant des sondes urinaires et / ou des tubes d’alimentation et des dispositifs sans sonde ont été élevés chaque mois pour le SARM et l’ERV, et des données cliniques ont été enregistrées. Résultats L’incidence de la cocolonisation du SARM / ERV chez les résidents ayant un appareil à demeure était par mois-résident; % d’intervalle de confiance [IC]: – parmi ceux sans dispositif, la cocolonisation SARM / ERV dans le groupe d’appareils est la plus fréquente dans les plaies par mois-résidents Dans une analyse de régression logistique limitée aux résidents avec dispositifs, taux d’incapacité fonctionnelle [RR], ; % CI: – et présence de plaie RR,; % CI: – étaient des facteurs de risque indépendants de cocolonizationConclusions Dans une population de résidents de SNF, les individus avec des dispositifs à demeure qui avaient aussi une incapacité fonctionnelle ou des blessures étaient plus à risque de cocolonization SARM / ERV Ces personnes devraient être régulièrement surveillées pour la présence de la colonisation VRSA

Depuis la découverte du premier isolat de VRSA résistant à la vancomycine Staphylococcus aureus, d’autres cas ont été signalés, le plus récent étant survenu en avril . Fait intéressant, le vancomycine est couramment utilisé pour traiter le S aureus résistant à la méthicilline. SARM Les infections et tous les VRSA isolés à ce jour ont été résistants à la vancomycine en plus de la méthicilline, l’émergence de VRSA est une préoccupation majeure Résistance élevée à la vancomycine en S aureus CMI ≥ μg / mL lorsque le gène de résistance à la vancomycine d’un entérocoque résistant à la vancomycine ERV, une bactérie qui colonise couramment le tractus gastro-intestinal humain L’acquisition de vanA se produit par transfert conjugal direct d’ADN de ERV à SARM fréquemment médié par la famille Inc de plasmides , rendant la proximité requise pour acquisition Ainsi, la cocolonisation avec MRSA et VRE est nécessaire pour le transfert de vanA et l’émergence subséquente de la VRSA En effet, plusieurs des VR Par conséquent, comme la co-colonisation SARM / ERV précède l’émergence de la SARV, nous avons choisi d’étudier l’incidence de la cocolonisation du SARM et de l’ERV dans les FSN des établissements de soins infirmiers spécialisés, une population de longue durée. Des études antérieures ont porté sur les taux de prévalence de la cocolonisation à SARM / ERV, mais elles ont été limitées aux cultures cliniques ou aux cultures de surveillance à partir de sites corporels spécifiques, comme la cocolonisation à SARM / ERV. nars SARM surveillance ou rectum VRE surveillance Pourtant pour presque tous les cas documentés de VRSA, les isolats VRSA ont été récupérés de plaies Par conséquent, nous étions intéressés à utiliser un plan d’étude prospectif pour estimer le taux d’incidence global de SARM / ERV cocolonisation parmi les résidents de SNF, ainsi que la façon dont les taux d’incidence varient selon les différents sites corporels, en particulier les blessures. La présente étude examine Les analyses précédentes de notre groupe ont démontré que les résidents de SNF avec des dispositifs à demeure sont plus à risque de colonisation multi-sites avec des organismes résistants aux antibiotiques Parce que beaucoup de facteurs de risque pour la colonisation indépendante Nous avons utilisé une approche de surveillance prospective pour identifier les facteurs de risque et les taux d’incidence de la cocolonisation avec le SARM et l’ERV chez les patients atteints de SARM ou d’ERV. Résidents de SNF dans le sud-est du Michigan

MATÉRIAUX ET MÉTHODES

Conception de l’étude et population

Cette étude observationnelle prospective impliquant des FNR communautaires dans le sud-est du Michigan a été menée entre octobre et janvier. Les établissements acceptaient les résidents des hôpitaux locaux mais n’étaient pas hospitalisés. La taille des lits variait et le personnel et les résidents n’étaient pas partagés ou transférés entre Tous les résidents ayant un appareil à demeure et / ou un cathéter urinaire ont été identifiés et invités à s’inscrire à l’étude. À l’inscription d’un résident avec un dispositif à demeure, un résident sans dispositif. a été sélectionné au hasard en utilisant un générateur de nombres aléatoires et a demandé à s’inscrire. Tous les résidents ont été suivis pendant un mois maximum ou jusqu’à leur décès, refus de culture, transfert ou retrait d’appareil. Les données démographiques ont été enregistrées et les données cliniques et microbiologiques ont été obtenues. visites Cette étude a été approuvée par l’Université du Michigan et les vétérans Affai Régime de soins de santé Ann Arbor Conseils d’examen institutionnel Le consentement éclairé écrit a été obtenu de tous les résidents inscrits ou de leur procuration durable

Collecte de données et variables

L’âge, le sexe et la durée de séjour antérieure du participant au SNF ont été enregistrés lors de l’inscription des résidents qui avaient été à l’établissement pour & gt; Les données cliniques, y compris l’utilisation d’antibiotiques, la présence de plaies, y compris les ulcères de pression, et l’hospitalisation, tous les jours précédents, ont été obtenues auprès de tous les résidents inscrits à chaque visite d’étude mensuelle. L’indice de comorbidité de Charlson a été utilisé pour attribuer un score de comorbidité allant de l’endroit où est la comorbidité L’échelle d’auto-entretien physique de Lawton et Brody a été utilisée pour évaluer l’état fonctionnel à chaque visite d’étude et pour décrire les résidents les plus dépendants physiquement

Méthodes microbiologiques et moléculaires

À chaque visite d’étude mensuelle, des échantillons de culture ont été prélevés sur les narines antérieures, l’oropharynx, l’aine et la région périanale à l’aide d’écouvillons à rayonne Culturette Becton Dickenson, Inc En outre, des tubes entériques et des ulcères de pression ont été prélevés. Tous les échantillons ont été testés pour SARM et ERV voir ci-dessous Un participant a refusé de fournir des spécimens, donc résident-mois dans le groupe de dispositifs est absent pour les narines et oropharynx Pour l’isolement et l’identification de S aureus, tous les écouvillons ont été striés sur gélose au mannitol Les colonies présumées pour S aureus sur la base du phénotype ont été confirmées par test de catalase positif et agglutination avec un test rapide pour la protéine A Fisher Healthcare Croissance sur gélose Mueller-Hinton BD contenant oxacilline μg / mL identifié SARM Toutes les colonies de MRSA ont ensuite été testé pour la résistance à la vancomycine sur gélose Mueller-Hinton contenant de la vancomycine μg / mL De plus, tous les écouvillons VRE a été confirmé par électrodéposition sur gélose au soja trypsique contenant du sang de mouton et des tests pyroglutamate-aminopeptidase positifs pyrrolidonyl-bêta-naphtylamidePolymérase en chaîne par PCR en utilisant des paires d’amorces: E: atcaagtacagttagtct et E: acgattcaaagctaactg et F: tagagacattgaatatgcc et F: tcgaatgtgctacaatc identifiés E faecalis et E faecium, respectivement Pour l’identification des plasmides de type Inc, la PCR a été réalisée avec des paires d’amorces: vanA F: catgaatagaataaaagttgctgcaata et vanA R: cccctttaacgctaatacgatcaa; TRAIN F: taatcgcaatggcttcttatc et TRAA R: tctgcccaatctttacgaat; et repR F: gcttcatgacggcttgtta et repR R: ttggctgctttgacagattta La PCR a été réalisée dans des réactions -μL avec -μL colonie resuspendue dans dHO stérile comme conditions de PCR de matrice étaient les suivantes: minutes à ° C; cycles de secondes à ° C, secondes à ° C et minutes à ° C; et minutes à ° C

Mesures de résultats

Notre résultat principal était les taux d’incidence de la cocolonisation au SARM et ERV définis comme une colonisation avec SARM et ERV lors de la même visite à partir de n’importe quelle combinaison de sites. Un résident pouvait être colonisé avec ERV et SARM au même site anatomique p. La colonisation avec SARM seul ou ERV seulement au niveau du résident a été définie de la même façon, comme la colonisation avec SARM ou ERV à tout site anatomique. Pour déterminer les taux d’incidence anatomiques spécifiques au site, l’isolement simultané du SARM et de l’ERV le même écouvillon de culture était considéré comme une cocolonisation MRSA / ERV

Analyses statistiques

Nous avons identifié des différences dans les caractéristiques cliniques et démographiques entre les groupes de dispositifs et de non-toxicomanie au départ. Un test a été utilisé pour détecter les différences dans les variables catégoriques et un test de Student pour les différences dans les variables continues. En utilisant la régression logistique, nous avons estimé les rapports de taux de cocolonisation chez les résidents ayant des dispositifs utilisant différentes populations de comparaison de base: tous les résidents avec des dispositifs dans l’étude, tous les résidents Cette analyse met en évidence les différences dans les résultats en fonction des populations de base utilisées pour ces analyses. Nous avons utilisé des équations d’estimation généralisées pour décrire les associations entre la cocolonisation à SARM / ERV et les caractéristiques cliniques et démographiques. ajuster pour les mesures répétées conception de l’étude Une fonction de liaison log avec une distribution de Poisson a été utilisée pour calculer les rapports de taux de cocolonisation MRSA / ERV avec des variances d’erreur robustes Les données ont été analysées en utilisant SAS, version

RÉSULTATS

Caractéristiques de la population étudiée

Au total, les résidents des FNR communautaires ont été recrutés: avec des appareils à demeure et sans dispositif. Le nombre moyen de résidents inscrits par FRN était de l’ordre de grandeur, – Les résidents ont été suivis pendant un total de mois-résidents moyens; Dans le groupe des appareils et dans le groupe des non-clients, les résidents avec appareils différaient significativement de toutes les caractéristiques par rapport aux autres résidents, à l’exception de la proportion de résidents diabétiques. Les dispositifs à demeure sont un facteur de risque important pour la colonisation avec des organismes résistants aux antibiotiques. Tableau et , nous avons stratifié par groupe de dispositifs pour toutes les analyses subséquentes.

Tableau Caractéristiques de base des établissements de soins infirmiers qualifiés Résidentiel Caractéristique du dispositif Non-valeur P du P Non% de l’ensemble des résidents Moyenne ± SD Âge, années Score de comorbidité de Charlson Suivi, mois & lt; PSMS Non% des résidents Homme Diabète Présence de plaies Usage antibiotique & lt; Hospitalisation & lt; Long stayers & gt; jours & lt; Type d’appareil Cathéter urinaire … Tube d’alimentation … Les deux .. photosensibilité. Caractéristique de l’appareil Non-périphérique P Valeur Non% des résidents dans l’ensemble Moyenne ± SD Âge, années Score de comorbidité de Charlson Suivi, mois & lt; PSMS Non% des résidents Homme Diabète Présence de plaies Usage antibiotique & lt; Hospitalisation & lt; Long stayers & gt; jours & lt; Type d’appareil Cathéter urinaire … Tube d’alimentation … Les deux … Étude de surveillance prospective de Staphylococcus aureus résistant à la méthicilline et d’entérocoques résistants à la vancomycine cocolonization menées dans des établissements de soins infirmiers qualifiés dans le Michigan, Octobre à Janvier Abréviation: PSMS, Statut d’Autonomie Physique

Tableau Taux d’incidence / Mois de résidence de Staphylococcus aureus résistants à la méthicilline / entérocoques résistants à la vancomycine MRSA / VRE Cocolonisation, colonisation par SARM seule et colonisation à ERV seule, stratifiée par dispositif Groupe Dispositif global NévEr EV IR EV IR EV IR IRRa SARM / VRE cocolonisation – – – – * SARM seulement – – – – * ERV seulement – – – – Nv périphérique EV EV EVIR EV IR IRRa MRSA / VRE cocolonisation – – – – * SARM seulement – – – – * ERV seulement – – – – Prospective étude de surveillance de la cocolonisation de Staphylococcus aureus résistant à la méthicilline-résistante / entérocoque résistant à la vancomycine menée dans des établissements de soins infirmiers spécialisés au Michigan, octobre à janvier n = Abréviations: EV, nombre de mois de résidence colonisés; IR, taux d’incidence / résidents-mois; TRI, taux d’incidence; SARM / ERV, Staphylococcus aureus résistant à la méthicilline / entérocoque résistante à la vancomycine Taux d’incidence de la colonisation pour le groupe de dispositifs comparé au groupe de non-valeur ajusté pour des mesures répétées en utilisant des équations d’estimation généralisées * P & lt; Voir grand

Quatorze résidents ont été colonisés par le SARM et l’ERV

Au niveau des résidents, les résidents étaient cocolonized avec SARM et ERV sur au moins la visite d’étude, à n’importe quelle combinaison de sites corporels décrits en noir dans Figure Les résidents cocolonized provenaient de différents SNFs Il n’y avait aucune évidence de regroupement de résidents cocolonized dans les installations ou au fil du temps Le plus grand nombre de résidents cocolonized à une installation simple était; cette installation comptait le plus grand nombre de participants. La colonisation avec le SARM et l’ERV au niveau des résidents était dynamique chez chaque résident au fil du temps et se produisait chez les résidents avec dispositifs et chez les résidents sans dispositif. Figure MRSA et ERV colonisation étaient prédictives l’un de l’autre, et la cocolonisation est plus fréquente chez les résidents colonisés par ERV que chez ceux qui ont été colonisés avec des données SARM non montrées

Figure Vue largeDownload slideColonisation des résidents d’un minimum de visite au cours d’une étude de surveillance prospective de Staphylococcus aureus résistant à la méthicilline MRSA et entérocoque résistant à la vancomycine ERV cocolonization menée dans des établissements de soins infirmiers qualifiés au Michigan, Octobre à Janvier n = Chaque rangée représente la suivante temps d’attente pour un seul participant à l’étude L’axe horizontal supérieur indique le nombre de jours de post-inscription. Chaque rectangle vertical représente une visite d’étude pour un résident particulier; les sites anatomiques éligibles à la culture: N = nare, O = oropharynx, G = aine, R = rectum, D = appareil, et W = plaie ou ulcère de pression Les boîtes colorées indiquent que le SARM vert a été cultivé sur ce site, jaune VRE, et les deux SARM et VRE bleu, aucun organisme présent contour noir ou gris non cultivé Résidents ont été définis comme cocolonized pour l’analyse au niveau du patient s’ils ont été colonisés avec SARM et ERV sur la même visite d’étude à toute combinaison de sites rectangles verticaux noirs soulignés cocolonisé pour l’analyse au niveau du site si MRSA et ERV étaient tous deux isolés du même site anatomique lors d’une visite d’étude Les résidents avaient des dispositifs à demeure sont indiqués sur l’axe des ordonnéesFigure View largeTélécharger les schémas de colonisation des résidents cocolonisé un minimum de visite lors d’une surveillance prospective étude de la staphylococcie aureus résistante à la méthicilline et de la cocolonisation de l’entérocoque résistant à la vancomycine résistante à la vancomycine menée dans des établissements de soins infirmiers spécialisés à Mic higan, octobre à janvier n = Chaque rangée représente le temps de suivi pour un participant à l’étude. L’axe horizontal supérieur indique le nombre de jours de post-inscription. Chaque rectangle vertical représente une visite d’étude pour un résident particulier. les sites anatomiques éligibles à la culture: N = nare, O = oropharynx, G = aine, R = rectum, D = appareil, et W = plaie ou ulcère de pression Les boîtes colorées indiquent que le SARM vert a été cultivé sur ce site, jaune VRE, et les deux SARM et VRE bleu, aucun organisme présent contour noir ou gris non cultivé Résidents ont été définis comme cocolonized pour l’analyse au niveau du patient s’ils ont été colonisés avec SARM et ERV sur la même visite d’étude à toute combinaison de sites rectangles verticaux noirs soulignés cocolonisé pour l’analyse au niveau du site si le SARM et l’ERV étaient tous deux isolés du même site anatomique lors d’une visite d’étude Les résidents avaient des dispositifs à demeure sont indiqués sur l’axe des ordonnées Le taux d’incidence de la cocolonisation était% intervalle de confiance [IC]: chez les résidents ayant un dispositif par rapport à ceux qui n’en avaient pas, après ajustement pour les mesures répétées Parmi les résidents ayant un dispositif, le taux d’incidence de la co-colonisation SARM / ERV était moins élevé que celui de la colonisation par SARM seule b De plus, les résidents avec des dispositifs étaient plus susceptibles d’être colonisés par SARM / ERV ou colonisés individuellement avec SARM ou ERV que les résidents sans dispositif. Tableau: le taux d’incidence de la cocolonisation comparé à la colonisation avec SARM seul était% CI: – et la colonisation avec VRE seul était% CI: –

Associations de caractéristiques cliniques et démographiques avec Cocolonization MRSA / VRE

Nous avons utilisé le statut de cocolonisation au niveau des résidents pour que l’analyse des facteurs de risque soit comparable aux études précédentes. En outre, nous avons pensé que chez un patient, une auto-inoculation et une contamination croisée des sites pourraient se produire. Pour chaque augmentation d’unité de score d’échelle physique et d’autosuffisance, il y a une augmentation de% du taux de cocolonisation MRSA / ERV.% IC: – Le taux de MRSA / RVC cocolonization dans les résidents de dispositif avec des blessures était des temps que chez les résidents sans blessures% CI: – Tableau

Tableau Associations entre résistants à la méthicilline Staphylococcus aureus / Entérocoques résistants à la vancomycine Cocolonisation et caractéristiques cliniques et démographiques aCRSA / ERV cocolonisationb Aucune cocolonisationc SARM seulementdREVRE seulement Caractéristique n = n = rapport de taux% CI n = rapport de taux% CI n = rapport de taux% CI Âge moyen, années – – – SCC – – – Suivi, mois – – – * PSMS – *** – * – * Non% des résidents Homme – – * – Diabète – – – Blessure – ** – ** – Antibiotiques – – * – * Hospitalisation – – – Séjour prolongé – – – MRSA / VRE cocolonizationb Pas de cocolonisationc MRSA seulementd VRE onlye Caractéristique n = n = rapport de taux% CI n = rapport de taux% CI n = Taux Taux% CI Âge moyen, années – – – SCC – – – Suivi, mois – – – * PSMS – *** – * – * Non% des résidents Homme – – * – Diabète – – – Blessure – ** – ** – Antibiotiques – – * – * Hospitalisation – – – Long stayf – – – Etude prospective de surveillance de la cocolonisation de Staphylococcus aureus résistant à la méticilline / entérocoques résistants à la vancomycine MRSA / ERV dans des centres de soins qualifiés au Michigan, octobre à janvier n = Les participants cocolonisés sont comparés à tous les autres participants, à ceux colonisés uniquement par SARM, et à ceux colonisés uniquement par VREAbreviations: n, nombre de résidents-mois colonisés; CCS, échelle de score de comorbidité de Charlson, – avec une comorbidité croissante; PSMS, Échelle d’évaluation de l’auto-évaluation physique, -, avec incapacité fonctionnelle croissanteaAjustée pour les mesures répétées utilisant des équations d’estimation généralisées. La cocolonisation MRRS / ERV est le résultat de chaque analyse. Les sous-populations dans lesquelles les analyses de régression logistique ont été effectuées sont indiquées aux notes c, d et Les résidents de l’appareil ecAll incluaient les résidents isolés individuellement avec ERV seul ou SARM alonedMRSA seulement colonisationeVRE seulement colonisationfAdmission à l’établissement & gt; jours * P & lt; ** P & lt; *** P & lt; Les résidents ayant reçu des antibiotiques au cours des jours précédents ont presque multiplié les taux de cocolonisation par SARM / ERV par rapport aux résidents qui ont reçu des antibiotiques, contrairement aux résidents ayant contracté le SARM seul ou aux ERV seuls. ne pas recevoir le rapport de taux d’antibiotiques [RR]; % CI: – Statut fonctionnel RR,; % IC: -, sexe masculin RR,, IC%: -, et plaies RR,; % IC: – étaient également significativement associés à la cocolonisation chez les résidents colonisés par le SARM Tableau D’autre part, dans le groupe colonisé ERV, les résidents étaient moitié moins susceptibles d’être cocolonized avec MRSA s’ils ont reçu des antibiotiques dans les jours précédents RR; % CI: – Tableau Parmi les résidents colonisés avec ERV, encore une fois augmentation de score physique et d’auto-entretien était significativement associée à la cocolonisation RR; % CI: –

Taux d’incidence de la co-colonisation par site anatomique

Les taux d’incidence de la cocolonisation avec SARM et ERV ont été déterminés pour différents sites anatomiques et comparés avec le taux de colonisation avec SARM seul et VRE seul. Pour l’analyse au niveau du site, la cocolonisation a été définie comme une colonisation simultanée avec SARM et ERV au même site. Dans le groupe des dispositifs, le taux d’incidence de la cocolonisation avec SARM et ERV était le plus élevé dans les plaies et les mois rectum / et / mois-résidents, respectivement. Note: la cocolonisation MRSA / ERV n’a jamais été observée dans les narines En outre, dans le groupe de dispositifs, lorsque les dispositifs et les plaies étaient colonisés avec ERV, il y avait toujours cocolonization avec MRSA Table Important, la cocolonization MRSA / VRE se produisait seulement dans le rectum dans les résidents de nondevice, à un taux de / resident-mois

Tableau Taux d’incidence par résident-mois de co-colonisation avec Staphylococcus aureus résistant à la méthicilline MRSA et entérocoque résistant à la vancomycine ERV, colonisation avec ERV seulement et colonisation avec SARM uniquement sur différents sites anatomiques stratifiés par groupe d’appareils Taux d’incidence% CI CI Nondevice MRSA / VRE ERV SARM seulement sur SARM / VRE ERV seulement SARM seulement Nares – – Oropharynx – – – Aine – – – – – Rectum – – – – – – Dispositif – – … … … Blessure – – – Taux d’incidence% CI Clavicule d’appareil SARM / VRE VRE SARM seulement sur SARM / VRE ERV seulement SARM seulement Nares – – Oropharynx – – – Aine – – – – – Rectum – – – – – – Dispositif – – … – … – Étude de surveillance prospective de Staphylococcus aureus résistant à la méthicilline etcocolonisation des entérocoques résistants à la vancomycine dans des établissements de soins infirmiers spécialisés du Michigan, octobre à janvier n = Abréviations: IC, intervalle de confiance; SARM, Staphylococcus aureus résistant à la méthicilline; ERV, entérococcie résistante à la vancomycine Il y a eu et mois-résidents exposés dans le groupe de dispositifs et dans le groupe de non-toxicomanie, respectivement.

Analyse moléculaire des isolats d’ERV

Nous avons utilisé la PCR de gènes ddl spécifiques aux entérocoques pour identifier tous les isolats d’ERV au niveau de l’espèce E faecalis a été isolé plus fréquemment dans les groupes de dispositifs et de non-périphériques et représentait plus de la moitié des isolats d’ERV. communément parmi les résidents cocolonisés% par rapport aux résidents qui n’étaient pas cocolonized%, bien que cette différence n’était pas statistiquement significative P = Plasmides de la famille Inc ont été associés à plusieurs cas de VRSA en raison de la conjugaison réussie avec SARM Par conséquent, nous avons déterminé prévalence des plasmides de type Inc dans notre population étudiée La PCR pour les gènes repR, traA et vanA a été utilisée pour identifier les plasmides de type Inc portés par les isolats d’entérocoques. Seul% des isolats d’ERV étaient positifs pour la présence de plasmides de type Inc. Ceci est similaire à la prévalence des plasmides de type Inc rapporté par Zhu et al pour les USI dans le Michigan

DISCUSSION

Dans cette étude prospective des résidents des FSR dans le sud-est du Michigan, l’incidence de SARM / ERV cocolonization était / résident-mois en général et% CI: – fois plus élevé chez les résidents avec dispositifs à demeure comparativement aux résidents sans Ours est la première étude Ce protocole nous a permis d’identifier les plaies comme le site le plus commun pour la cocolonisation par rapport à d’autres sites cultivés chez les patients avec des dispositifs à demeure. Conformément à nos résultats est celui de précédemment rapporté des cas de VRSA ont été identifiés à partir de plaies Les plaies peuvent être un réservoir important pour l’émergence de la SARV en raison de la propension à la formation de biofilms dans les plaies; Les dispositifs à demeure sont un facteur de risque bien connu pour la colonisation par des organismes résistants aux antibiotiques Nous montrons que le risque de cocolonisation MRSA / ERV est plus élevé chez les personnes ayant des dispositifs à demeure, tout comme la cocolonisation. Chez les résidents sans dispositif, la cocolonisation MRSA / ERV a eu lieu seulement sur un seul site, le rectum. Fait intéressant, nous n’avons observé aucune co-colonisation parmi les plaies présentes chez les résidents sans dispositifs à demeure. un dispositif à demeure peut présenter un risque spécifique de SARM / ERV cocolonisation de la blessureMRSA et la colonisation ERV ne sont pas indépendants les uns des autres; ceci n’est pas surprenant étant donné la similarité des facteurs de risque, tels que la présence de dispositifs à demeure, l’utilisation d’antibiotiques et la durée du séjour à l’hôpital, tant pour la colonisation de SARM seule que pour la colonisation par ERV seule. Groupes colonisés par SARM et colonisés par ERV Parmi les résidents colonisés par SARM dans le groupe des dispositifs,% des résidents-mois ont également été colonisés par ERV ainsi cocolonisés comparativement à ceux colonisés par ERV, où% des résidents-mois ont également été colonisés par SARM. De plus, la colonisation par ERV seule n’a jamais eu lieu au niveau du dispositif ou des sites de plaies chez les résidents ayant des dispositifs à demeure; Ainsi, si les résidents étaient colonisés par ERV à ces sites, ils étaient toujours colonisés par le SARM ou cocolonisés. Ainsi, nos résultats appuient l’hypothèse selon laquelle la prévention de la colonisation par ERV chez les résidents avec dispositifs à demeure limiterait la co-colonisation SARM / ERV. Étant donné que nous avons limité notre étude des facteurs de risque de la cocolonisation du SARM / ERV aux résidents ayant des appareils à demeure, il est difficile de déterminer la véritable signification de la colonisation par SARM / ERV. En outre, il serait intéressant de connaître les facteurs de risque de cocolonisation spécifiques à chaque site anatomique. Néanmoins, nous présentons des facteurs de risque importants pour la cocolonisation parmi les résidents de SNF avec des dispositifs à demeure, un cohorte à haut risque commune dans ces établissements Increasin La prise de conscience du rôle joué par l’état fonctionnel dans la colonisation par de multiples agents pathogènes pharmacorésistants a conduit à des études cliniques qui étudient spécifiquement cette association Des études supplémentaires sont nécessaires pour confirmer ces résultats, ainsi que d’identifier d’autres facteurs de risque de cocolonisation. La cocolonisation de SARM / ERV dans la littérature varie considérablement, de% à% La vaste gamme d’estimations de prévalence précédentes peut s’expliquer par la variabilité des populations étudiées, l’utilisation de cultures cliniques et / ou de surveillance, et si le Dans notre étude prospective, la prévalence transversale de la cocolonisation au départ était de% lorsque la surveillance active était effectuée sur des sites anatomiques indépendamment de l’état de colonisation antérieur par le SARM ou l’ERV. être une meilleure représentation de la prévalence réelle Parce que nous avons trouvé que les blessures étaient les plus site commun de SARM / ERV cocolonisation chez les résidents avec des dispositifs, des études supplémentaires devraient être menées pour déterminer les facteurs de risque spécifiques à la cocolonisation des plaies et leur interaction avec l’état du dispositif. La cocolonisation étant un précurseur important de l’émergence des VRSA, il est crucial d’identifier les groupes à haut risque. plus propice aux interventions de prévention des infections Plus la prévalence de la cocolonisation MRSA / ERV est élevée, plus la possibilité de transfert de gène conduisant à de nouvelles souches de VRSA peut se transmettre entre personnes, un événement qui n’a pas encore été documenté

Remarques

Remerciements

Les auteurs aimeraient remercier Bonnie Lansing, Jay Fisch et Tisha Moore pour l’inscription des participants et la collecte des échantillons, Kathleen Symons et Kay Cherian pour le traitement des échantillons, et Heidi Reichert pour l’aide aux analyses statistiques.

Aide financière

LM a été soutenu par NIA K AG, bourse d’études ASP / AGS T Franklin Williams, NIA RAG et le Centre Claude D Pepper Old Independence Indépendance et Michigan Institut de recherche clinique et de santé, Université du Michigan Programme de subvention pilote EF a été soutenu par un printemps Rackham / Subvention de recherche d’été

Conflits d’intérêts potentiels

Tous les auteurs: Aucun conflit rapporté Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués